|
OriGene
ho 1 ![]() Ho 1, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+1/Heme+Oxygenase+1+(HMOX1)+Human+qPCR+Primer+Pair/pmc13209369-269-20-24 Average 94 stars, based on 1 article reviews
ho 1 - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
Sangon Biotech
primer of claudin 1 ![]() Primer Of Claudin 1, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+1/anti+conjugated+goat+hrp+igg+rabbit/pmc13127400-67-0-10 Average 86 stars, based on 1 article reviews
primer of claudin 1 - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Jackson Laboratory
forward primer 1 ![]() Forward Primer 1, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+1/genotyping+primers+standard/bio_rxiv__64898__2026__05__12__724462-63-8-5 Average 86 stars, based on 1 article reviews
forward primer 1 - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
human slc7a1 1 rna primers f tcctgctttggctccatgaacg r agaggagtgtgcttgcggacat ![]() Human Slc7a1 1 Rna Primers F Tcctgctttggctccatgaacg R Agaggagtgtgcttgcggacat, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+1/apoa1+biotech+ccctgggatcgagtgaagga+f+gcaggtaatcccaaaagcgac+primer+r+sangon/pmc13019507-95-0-10 Average 86 stars, based on 1 article reviews
human slc7a1 1 rna primers f tcctgctttggctccatgaacg r agaggagtgtgcttgcggacat - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
OriGene
b member 1 ![]() B Member 1, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+1/Cyp1b1+Mouse+qPCR+Primer+Pair/pmc13201606-64-33-41 Average 94 stars, based on 1 article reviews
b member 1 - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
Thermo Fisher
hs gapdh 1 sg quantitect primer assay qt00079247 qiagen ![]() Hs Gapdh 1 Sg Quantitect Primer Assay Qt00079247 Qiagen, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+1/Hs_GAPDH_1_SG+QuantiTect+Primer+Assay+QT00079247+Qiagen/pm41931390-215-271-267 Average 94 stars, based on 1 article reviews
hs gapdh 1 sg quantitect primer assay qt00079247 qiagen - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
Premier Biosoft
beacon primer designer 8 1 ![]() Beacon Primer Designer 8 1, supplied by Premier Biosoft, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+1/beacon+designer+software/pmc13038559-133-30-34 Average 86 stars, based on 1 article reviews
beacon primer designer 8 1 - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
New England Biolabs
nebnext multiplex small rna library prep kit ![]() Nebnext Multiplex Small Rna Library Prep Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+1/NEBNext+Multiplex+Small+RNA+Library+Prep+Kit+for+Illumina+(Index+Primers+1/bio_rxiv__64898__2026__03__11__711085-103-14-21 Average 98 stars, based on 1 article reviews
nebnext multiplex small rna library prep kit - by Bioz Stars,
2026-09
98/100 stars
|
Buy from Supplier |
|
New England Biolabs
nebnext 4 multiplex oligos for illumina dual index primers sets 1 and 2 ![]() Nebnext 4 Multiplex Oligos For Illumina Dual Index Primers Sets 1 And 2, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+1/NEBNext+Multiplex+Oligos+for+Illumina/pm41810521-233-7-7 Average 96 stars, based on 1 article reviews
nebnext 4 multiplex oligos for illumina dual index primers sets 1 and 2 - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
Illumina Inc
tempo seq custom index 1 sequencing primer ![]() Tempo Seq Custom Index 1 Sequencing Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+1/HT1+Buffer/us12571046-233-4-21 Average 96 stars, based on 1 article reviews
tempo seq custom index 1 sequencing primer - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
Journal: Molecules
Article Title: Subcritical Water Extract from Grape Pomace Protects Human Bronchial Epithelium Cells by Mitigating Oxidative Stress Through Nrf2 Pathway
doi: 10.3390/molecules31101736
Figure Lengend Snippet: SWE 160.1 treatment increased the antioxidant response. ( a ) Western blotting analysis of antioxidant factors (HO-1, SOD-2 and Nrf2) after 48 h of treatment with 75 and 100 µg GAE/mL SWE 160.1 in HBE cells. Protein levels were normalized to γ-tubulin. ( b ) qRT-PCR analysis of Nrf2, Keap1 and HO-1 mRNA levels after 24 h of treatment with 75 and 100 µg GAE/mL SWE 160.1 in HBE cells. Gene expression levels represent the relative mRNA expression compared to the untreated cells, normalized to GAPDH mRNA. ( c ) Western blotting of subcellular fractions of control and 48 h SWE 160.1 -treated cells incubated with pNrf2 (Ser40) antibody. Lamin A and GADPH antibodies marked as nuclei (N) and cytoplasmic (C) fractions, respectively. The images are representative of three different experiments. * p < 0.05, ** p < 0.01 vs. untreated control cells.
Article Snippet: The primers used were GAPDH (Proligo USA, Milan, Italy), Nrf2 ( HP209154 , OriGene Technologies, Inc., Rockville, MD, USA) and
Techniques: Western Blot, Quantitative RT-PCR, Gene Expression, Expressing, Control, Incubation
Journal: Molecules
Article Title: Subcritical Water Extract from Grape Pomace Protects Human Bronchial Epithelium Cells by Mitigating Oxidative Stress Through Nrf2 Pathway
doi: 10.3390/molecules31101736
Figure Lengend Snippet: SWE 160.1 treatment overwhelmed LPS-induced HO-1-reduction. Western blotting analysis of HO-1 enzyme after 48 h of treatment with 2 µg/mL LPS alone or in combination with 100 µg GAE/mL SWE 160.1 . Protein levels were normalized to γ-tubulin. Densitometric analysis, performed using Quantity One software, (version 4.6.6), is shown in the histogram. The result is representative of two independent experiments, with values expressed as mean ± SD. ** p < 0.01 vs. untreated control cells.
Article Snippet: The primers used were GAPDH (Proligo USA, Milan, Italy), Nrf2 ( HP209154 , OriGene Technologies, Inc., Rockville, MD, USA) and
Techniques: Western Blot, Software, Control
Journal: iScience
Article Title: PAR2-β-arrestin 2-ERK axis mediates Malassezia globosa -induced IL-17 response by disrupting ZO-1 in keratinocytes
doi: 10.1016/j.isci.2026.115646
Figure Lengend Snippet: Expression of PAR2, IL-17, and TJ proteins in Malassezia folliculitis (A and B) PAR2, IL-17, ZO-1, occludin, and claudin-1 were validated in MF and CTRL skin tissue by immunohistochemical staining (IHC). Values are mean ± SD of six samples from two independent experiments. Statistical analysis was performed using a two-way ANOVA with Šídák’s multiple comparisons test (∗ p < 0.05; ∗∗∗ p < 0.001). (C and D) The spores rate of CTRL and MF groups by Periodic Acid-Schif staining. Purple arrows indicate the spores. Scale bars, 50 μm. Data are presented as mean ± SD of triplicate wells from three independent experiments. Statistical significance was determined using unpaired two-tailed Student’s t tests (∗∗ p < 0.01).
Article Snippet:
Techniques: Expressing, Immunohistochemical staining, Staining, Two Tailed Test
Journal: Scientific Reports
Article Title: Experimental pulmonary arterial hypertension in mice with a pathogenic SOX17 variant
doi: 10.1038/s41598-026-46893-0
Figure Lengend Snippet: Graphical abstract. AhR, aryl hydrocarbon receptor; Bmpr2, bone morphogenetic protein receptor type 2; Col4a, collagen, type IV, alpha; Cyp1b1, cytochrome P450 family 1 subfamily B member 1; SOX17, SRY-box transcription factor 17. Created in https://BioRender.com .
Article Snippet: The primers used were as follows: F: TGCACCACCAACTGCTTAG and R: GGATGCAGGGATGATGTTC for glyceraldehyde-3-phosphate dehydrogenase ( Gapdh ) as an endogenous control gene; F: GCCACTATTACGGACATCTTCGG and R: ACAACCTGGTCCAACTCAGCCT for cytochrome P450 family 1 subfamily
Techniques:
Journal: bioRxiv
Article Title: Orally Delivered dsRNA-Derived siRNAs Reach the Central Nervous System in Leptinotarsa decemlineata
doi: 10.64898/2026.03.11.711085
Figure Lengend Snippet: (a) Length distribution of RISC-associated small RNAs recovered from the CNS 24 h after dsmGFP exposure, showing a dominant 21-nt siRNA peak. (b) Strand-specific mapping of 21-nt siRNAs from the CNS sample onto the dsmGFP template, revealing a major antisense hotspot similar to that observed in CPB tissues. (c) Length distribution of RISC-bound small RNAs from the remaining tissues, demonstrating a tissue-specific shift to a predominant 22-nt siRNA population. (d) Strand-specific mapping of 22-nt siRNAs from the remaining tissues sample, showing relocation of the dominant antisense hotspot to a secondary region of the dsmGFP sequence.
Article Snippet: Libraries from purified small RNAs (∼500 ng RNA per sample) were prepared using the
Techniques: Sequencing